Antibody Engineering by Roland E. Kontermann, Stefan Dübel

By Roland E. Kontermann, Stefan Dübel

Curiosity in recombinant antibody applied sciences has quickly elevated end result of the wide selection of attainable functions in treatment and prognosis, in particular in melanoma remedy. the opportunity of producing human antibodies that aren't obtainable through traditional polyclonal or monoclonal ways has pressured the advance of antibody engineering applied sciences even more.
This handbook provides a complete number of particular, step by step protocols supplied by means of specialists within the box. All easy tools wanted in antibody engineering - not just how to generate recombinant antibodies, but additionally protocols for research and their use - and lately built and rising applied sciences are lined. specifically, protocols at the following issues are provided:
Hybridoma immortalisation iteration and screening of antibody gene libraries from human donors, mice and rabbits Antibody choice on immunotubes, cells, tissues; proximity and step-back choices production of human monoclonal antibodies to poisonous or hugely pathogenic brokers with out immunisation Improvment of antibody binding Antibody humanisation Genetic fusions for the creation of multifunctional antibody derivatives Radiolabelled recombinant antibodies Bispecific antibodies Antibody - enzyme fusions Intracellular antibodies decision of affinity and specificity machine research of antibody series and constitution Epitope research through numerous phage demonstrate platforms and peptide spot membranes Eukaryotic (plant, baculovirus, yeast, mammalian cells) and prokaryotic creation platforms for recombinant antibodies Purification platforms Xenograft mice rising applied sciences

Show description

Read Online or Download Antibody Engineering PDF

Similar diagnostics & labs books

Functional MRI Basic Principles and Clinical Applications

Practical magnetic resonance imaging (fMRI) measures speedy, tiny metabolic adjustments that ensue within the mind, supplying the main delicate process at the moment to be had for settling on, investigating, and tracking mind tumors, stroke, and persistent issues of the fearful method like a number of sclerosis, and mind abnormalities on the topic of dementia or seizures.

Molecular Biology and Biotechnology

This renowned textbook has been thoroughly revised and up-to-date to supply a accomplished evaluate and to mirror all of the most recent advancements during this swiftly increasing zone. Chapters at the impression of molecular biology within the improvement of biotechnology were totally up-to-date and comprise the functions of molecular biology within the components of drug layout and illnesses.

Student Workbook for Phlebotomy Essentials

It is a pupil workbook to accompany the 5th version of Phlebotomy necessities. The workbook is designed to aid scholars evaluation, perform, and verify their knowing of Phlebotomy necessities. The workbook builds at the association of the textual content and additional emphasizes LWW's specialise in pupil good fortune and figuring out in phlebotomy.

Analgesia, Anaesthesia and Pregnancy: A Practical Guide

Analgesia, Anaesthesia and being pregnant makes a speciality of pre-empting difficulties and maximising caliber of care. each bankruptcy of this well-established functional consultant has been thoroughly up-to-date and revised, keeping the idea that and structure of earlier variants. All points of obstetric medication correct to the anaesthetist are coated, from pre-pregnancy administration to belief, all through being pregnant, to postnatal care.

Additional info for Antibody Engineering

Example text

Coli alkaline phosphatase (AP) gene can be found in Shuttleworth et al. (1986). For the EcoRI/HindlII cloning cassette the two internal EcoRI sites of the AP gene have been removed by silent mutations. c: CTT ... HindIII VH SfiI EcoRI his tag ... C~TCGGGGGCCGAATTCCACCACCATCACCACCATTAATGAAAG A S G A E F H H H H H H * * pJB23scFv, pJB33scFv SfiI HindIII ... CTCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAATAAGCTT ... 1 F Y T M K A A 1 G 1 K * end AP VH EcoRI alkaline phosphatase (AP) ... CGGCCTCGGGGGCCGAATTCCGGACACCAGAAATGCCTGTTCTG ...

J Cl ~ 0: ""-< pAKIOOscFv pAKIOOscFv, pAK300scFv, pAK500scFv, pAK600scFv, pJB12scFv, pJB23scFv N 00 B A downstream sequence of pAK300scFv, pAK400scFv, pJB23scFv and pJB33scFv. The last two bases ofVH (bold), SfiI and EcoRI restriction sites and his6 tags are indicated above the sequence. D: sequences of EcoRI/HindlII fusion cassettes as used in pAKSOO and pAK600. The dHLX dimerization motif was taken from Pack et al. (1993). The complete sequence of the mature E. coli alkaline phosphatase (AP) gene can be found in Shuttleworth et al.

S o· 2'~ '" o :::s (') N 30 JORG BURMESTER and ANDREAS PLUCKTHUN Procedure Isolation of mRNA and eDNA synthesis 1. Take 1 to 5 million cells from a frozen or growing hybridoma (for iso- type determination use the Roche IsoStrip Mouse Monoclonal Antibody Isotyping Kit) culture or spleen cells, respectively (see note), and perform a mRNA preparation as described in the QuickPrep mRNA Purification Kit (Pharmacia). According to the manufacturer, this kit can be used for up to 5 X 107 cells, but in order to get extremely pure mRNA take only 5 x 106 cells per oligo(dT)-cellulose column included in the kit, which will yield 1-10 Ilg of mRNA.

Download PDF sample

Rated 4.00 of 5 – based on 33 votes